Usage

Table of contents

General Nextflow info

Nextflow handles job submissions on SLURM or other environments, and supervises running the jobs. Thus the Nextflow process must run until the pipeline is finished. We recommend that you put the process running in the background through screen / tmux or similar tool. Alternatively you can run nextflow within a cluster job submitted your job scheduler.

To create a screen session:

screen -R eager2

To disconnect, press ctrl+a then d.

To reconnect, type :

screen -r eager2

to end the screen session while in it type exit.

Help Message

To access the nextflow help message run: nextflow run -help

Running the pipeline

Before you start you should change into the output directory you wish your results to go in. When you start the nextflow job, it will place all the ‘working’ folders in the current directory and NOT necessarily the directory the output files will be in.

The typical command for running the pipeline is as follows:

nextflow run nf-core/eager --reads '*_R{1,2}.fastq.gz' --fasta 'some.fasta' -profile standard,docker

where the reads are from libraries of the same pairing.

This will launch the pipeline with the docker configuration profile. See below for more information about profiles.

Note that the pipeline will create the following files in your working directory:

work            # Directory containing the nextflow working files
results         # Finished results (configurable, see below)
.nextflow.log   # Log file from Nextflow
# Other nextflow hidden files, eg. history of pipeline runs and old logs.

To see the the EAGER pipeline help message run: nextflow run nf-core/eager --help

Updating the pipeline

When you run the above command, Nextflow automatically pulls the pipeline code from GitHub and stores it as a cached version. When running the pipeline after this, it will always use the cached version if available - even if the pipeline has been updated since. To make sure that you’re running the latest version of the pipeline, make sure that you regularly update the cached version of the pipeline:

nextflow pull nf-core/eager

See below for more details about EAGER2 versioning.

Mandatory Arguments

-profile

Use this parameter to choose a configuration profile. Profiles can give configuration presets for different computing environments (e.g. schedulers, software environments, memory limits etc). Note that multiple profiles can be loaded, for example: -profile standard,docker - the order of arguments is important! The first entry takes precendence over the others, e.g. if a setting is set by both the first and second profile, the first entry will be used and the second entry ignored.

Important: If running EAGER2 on a cluster - ask your system administrator what profile to use.

For more details on how to set up your own private profile, please see installation.

Basic profiles These are basic profiles which primarily define where you derive the pipeline’s software packages from. These are typically the profiles you would use if you are running the pipeline on your own PC (vs. a HPC cluster - see below).

  • awsbatch
    • A generic configuration profile to be used with AWS Batch.
  • conda
    • A generic configuration profile to be used with conda
    • Pulls most software from Bioconda
  • docker
    • A generic configuration profile to be used with Docker
    • Pulls software from dockerhub: nfcore/eager
  • singularity
    • A generic configuration profile to be used with Singularity
    • Pulls software from singularity-hub
  • conda
    • A generic configuration profile to be used with conda
    • Pulls most software from Bioconda
  • awsbatch
    • A generic configuration profile to be used with AWS Batch.
  • test
    • A profile with a complete configuration for automated testing
    • Includes links to test data so needs no other parameters
  • none
    • No configuration at all. Useful if you want to build your own config from scratch and want to avoid loading in the default base config profile (not recommended).

Institution Specific Profiles These are profiles specific to certain HPC clusters, and are centrally maintained at nf-core/configs. Those listed below are regular users of EAGER2, if you don’t see your own institution here check the nf-core/configs repository.

  • uzh
    • A profile for the University of Zurich Research Cloud
    • Loads Singularity and defines appropriate resources for running the pipeline.
  • binac
    • A profile for the BinAC cluster at the University of Tuebingen
    • Loads Singularity and defines appropriate resources for running the pipeline
  • shh
    • A profiler for the SDAG cluster at the Department of Archaeogenetics of the Max-Planck-Institute for the Science of Human History
    • Loads Singularity and defines appropriate resources for running the pipeline

--reads

Use this to specify the location of your input FastQ files. The files maybe either from a single, or multiple samples. For example:

--reads 'path/to/data/sample_*_{1,2}.fastq'

for a single sample, or

--reads 'path/to/data/*/sample_*_{1,2}.fastq'

for multiple samples, where each sample’s FASTQs are in it’s own directory (indicated by the first *).

Please note the following requirements:

  1. The path must be enclosed in quotes
  2. The path must have at least one * wildcard character
  3. When using the pipeline with paired end data, the path must use {1,2} notation to specify read pairs.

If left unspecified, a default pattern is used: data/*{1,2}.fastq.gz

Note: It is not possible to run a mixture of single-end and paired-end files in one run.

--singleEnd

If you have single-end data, you need to specify --singleEnd on the command line when you launch the pipeline. A normal glob pattern, enclosed in quotation marks, can then be used for --reads. For example:

--singleEnd --reads 'path/to/data/*.fastq'

for a single sample, or

--singleEnd --reads 'path/to/data/*/*.fastq'

for multiple samples, where each sample’s FASTQs are in it’s own directory (indicated by the first *)

Note: It is not possible to run a mixture of single-end and paired-end files in one run.

--pairedEnd

If you have paired-end data, you need to specify --pairedEnd on the command line when you launc hthe pipeline.

A normal glob pattern, enclosed in quotation marks, can then be used for --reads. For example:

--pairedEnd --reads '*.fastq'

--fasta

You specify the full path to your reference genome here. The FASTA file can have any file suffix, such as .fasta, .fna, .fa, .FastA etc. You may also supply a gzipped reference files, which will be unzipped automatically for you.

For example:

--fasta '/<path>/<to>/my_reference.fasta'

If you don’t specify appropriate --bwa_index, --fasta_index parameters (see below), the pipeline will create these indices for you automatically. Note that you can save the indices created for you for later by giving the --saveReference flag.

--large_ref

This parameter is required to be set for large reference genomes. If your reference genome is larger than 3.5GB, the samtools index calls in the pipeline need to generate CSI indices instead of BAI indices to accompensate for the size of the reference genome. This parameter is not required for smaller references (including a human hg19 or grch37/grch38 reference), but >4GB genomes have been shown to need CSI indices.

--genome (using iGenomes)

The pipeline config files come bundled with paths to the illumina iGenomes reference index files. If running with docker or AWS, the configuration is set up to use the AWS-iGenomes resource.

There are 31 different species supported in the iGenomes references. To run the pipeline, you must specify which to use with the --genome flag.

You can find the keys to specify the genomes in the iGenomes config file. Common genomes that are supported are:

  • Human
    • --genome GRCh37
    • --genome GRCh38
  • Mouse
    • --genome GRCm38
  • Drosophila
    • --genome BDGP6
  • S. cerevisiae
    • --genome 'R64-1-1'

There are numerous others - check the config file for more.

Note that you can use the same configuration setup to save sets of reference files for your own use, even if they are not part of the iGenomes resource. See the Nextflow documentation for instructions on where to save such a file.

The syntax for this reference configuration is as follows:

params {
  genomes {
    'GRCh37' {
      fasta   = '<path to the genome fasta file>' // Used if no star index given
    }
    // Any number of additional genomes, key is used with --genome
  }
}

Optional Reference Options

Generating Fresh Indices

--saveReference

Use this if you do not have pre-made reference FASTA indices for bwa, samtools and picard. If you turn this on, the indices EAGER2 generates for you will be stored in the <your_output_dir>/results/reference_genomes for you.

Premade Indices

Supplying pre-made indices saves time in pipeline execution and is especially advised when running multiple times on the same cluster system for example. You can even add a resource specific profile that sets paths to pre-computed reference genomes, saving even time when specifying these.

--bwa_index

If you want to use pre-existing bwa index indices, please supply the path and file to the FASTA you also specified in --fasta (see above). EAGER2 will automagically detect the index files by searching for the FASTA filename with the corresponding bwa index file suffixes.

For example:

nextflow run nf-core/eager \
-profile test_fna,docker \
--pairedEnd \
--reads *{R1,R2}*.fq.gz
--fasta results/reference_genome/bwa_index/BWAIndex/Mammoth_MT_Krause.fasta \
--bwa_index results/reference_genome/bwa_index/BWAIndex/Mammoth_MT_Krause.fasta

bwa index does not give you an option to supply alternative suffixes/names for these indices. Thus, the file names generated by this command must not be changed, otherwise EAGER2 will not be able to find them.

--seq_dict

If you want to use a pre-existing picard CreateSequenceDictionary dictionary file, use this to specify the required .dict file for the selected reference genome.

For example:

--seq_dict Mammoth_MT_Krause.dict

--fasta_index

If you want to use a pre-existing samtools faidx index, Use this to specify the required FASTA index file for the selected reference genome. This should be generated by samtools faidx and has a file suffix of .fai

For example:

--fasta_index Mammoth_MT_Krause.fasta.fai

Other command line parameters

-r

By default, EAGER2 will use the latest version of the pipeline that is downloaded on your system. However, it’s a good idea to specify a pipeline version when running the pipeline on your data. This ensures that a specific version of the pipeline code and software are used when you run your pipeline. If you keep using the same tag, you’ll be running the same version of the pipeline, even if there have been changes to the code since.

First, go to the nf-core/eager releases page and find the latest version number - numeric only (eg. 2.0). Then specify this when running the pipeline with -r (one hyphen) - eg. -r 2.0.

This version number will be logged in reports when you run the pipeline, so that you’ll know what you used when you look back in the future.

Additionally, EAGER pipeline releases are named after Swabian German Cities. The first release V2.0 is named “Kaufbeuren”. Future releases are named after cities named in the Swabian league of Cities.

--outdir

The output directory where the results will be saved.

--max_memory

Use to set a top-limit for the default memory requirement for each process. Should be a string in the format integer-unit. eg. --max_memory '8.GB'. If not specified, will be taken from the configuration in the -profile flag.

--max_time

Use to set a top-limit for the default time requirement for each process. Should be a string in the format integer-unit. eg. --max_time '2.h'. If not specified, will be taken from the configuration in the -profile flag.

--max_cpus

Use to set a top-limit for the default CPU requirement for each process. This is not the maximum number of CPUs that can be used for the whole pipeline, but the maximum number of CPUs each program can use for each program submission (known as a process). Do not set this higher than what is available on your workstation or computing node can provide. If you’re unsure, ask your local IT administrator for details on compute node capabilities! Should be a string in the format integer-unit. eg. --max_cpus 1. If not specified, will be taken from the configuration in the -profile flag.

--email

Set this parameter to your e-mail address to get a summary e-mail with details of the run sent to you when the workflow exits. If set in your user config file (~/.nextflow/config) then you don’t need to specify this on the command line for every run.

-name

Name for the pipeline run. If not specified, Nextflow will automatically generate a random mnemonic.

This is used in the MultiQC report (if not default) and in the summary HTML / e-mail (always).

NB: Single hyphen (core Nextflow option)

-resume

Specify this when restarting a pipeline. Nextflow will used cached results from any pipeline steps where the inputs are the same, continuing from where it got to previously.

You can also supply a run name to resume a specific run: -resume [run-name]. Use the nextflow log command to show previous run names.

NB: Single hyphen (core Nextflow option)

-c

Specify the path to a specific nextflow config file (this is a core NextFlow command).

NB: Single hyphen (core Nextflow option)

Note - you can use this to override pipeline defaults.

--custom_config_version

Provide git commit id for custom Institutional configs hosted at nf-core/configs. This was implemented for reproducibility purposes. Default is set to master.

## Download and use config file with following git commid id
--custom_config_version d52db660777c4bf36546ddb188ec530c3ada1b96

--plaintext_email

Set to receive plain-text e-mails instead of HTML formatted.

--multiqc_config

Specify a path to a custom MultiQC configuration file. MultiQC produces final pipeline reports.

Adjustable parameters for nf-core/eager

This part of the documentation contains a list of user-adjustable parameters in nf-core/eager. You can specify any of these parameters on the command line when calling the pipeline by simply prefixing the respective parameter with a double dash --

Step skipping parameters

Some of the steps in the pipeline can be executed optionally. If you specify specific steps to be skipped, there won’t be any output related to these modules.

--skip_fastqc

Turns off FastQC pre- and post-Adapter Removal, to speed up the pipeline. Use of this flag is most common when data has been previously pre-processed and the post-Adapter Removal mapped reads are being re-mapped to a new reference genome.

--skip_adapterremoval

Turns off adaptor trimming and paired-end read merging. Equivalent to setting both --skip_collapse and --skip_trim.

--skip_preseq

Turns off the computation of library complexity estimation.

--skip_deduplication

Turns off duplicate removal methods DeDup and MarkDuplicates respectively. No duplicates will be removed on any data in the pipeline.

--skip_damage_calculation

Turns off the DamageProfiler module to compute DNA damage profiles.

--skip_qualimap

Turns off QualiMap and thus does not compute coverage and other mapping metrics.

Complexity Filtering Options

--complexity_filter_poly_g

Performs a poly-G tail removal step in the beginning of the pipeline, if turned on. This can be useful for trimming ploy-G tails from short-fragments sequenced on two-colour Illumina chemistry such as NextSeqs (where no-fluorescence is read as a G on two-colour chemistry), which can inflate reported GC content values.

--complexity_filter_poly_g_min

This option can be used to define the minimum length of a poly-G tail to begin low complexity trimming. By default, this is set to a value of 10 unless the user has chosen something specifically using this option.

Adapter Clipping and Merging Options

These options handle various parts of adapter clipping and read merging steps.

--clip_forward_adaptor

Defines the adapter sequence to be used for the forward read. By default, this is set to AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC.

--clip_reverse_adaptor

Defines the adapter sequence to be used for the reverse read in paired end sequencing projects. This is set to AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA by default.

--clip_readlength 30

Defines the minimum read length that is required for reads after merging to be considered for downstream analysis after read merging. Default is 30.

--clip_min_read_quality 20

Defines the minimum read quality per base that is required for a base to be kept. Individual bases at the ends of reads falling below this threshold will be clipped off. Default is set to 20.

--clip_min_adap_overlap 1

Sets the minimum overlap between two reads when read merging is performed. Default is set to 1 base overlap.

--skip_collapse

Turns off the paired-end read merging.

For example

--pairedEnd --skip_collapse  --reads '*.fastq'

--skip_trim

Turns off adaptor and quality trimming.

For example:

--pairedEnd --skip_trim  --reads '*.fastq'

Read Mapping Parameters

BWA (default)

These parameters configure mapping algorithm parameters.

--bwaalnn

Configures the bwa aln -n parameter, defining how many mismatches are allowed in a read. By default set to 0.04, if you’re uncertain what to set check out this Shiny App for more information on how to set this parameter efficiently.

--bwaalnk

Configures the bwa aln -k parameter for the seeding phase in the mapping algorithm. Default is set to 2.

--bwaalnl

Configures the length of the seed used in bwa aln -l. Default is set to BWA default of 32.

CircularMapper

--circularmapper

This turns on the CircularMapper application, that enhances the mapping procedure with the BWA algorithm on circular references utilizing a extend-remap procedure (see Peltzer et al 2016, Genome Biology for details).

--circularextension

The number of bases to extend the reference genome with. By default this is set to 500 if not specified otherwise.

--circulartarget

The chromosome in your FastA reference that you’d like to be treated as circular. By default this is set to MT but can be configured to match any other chromosome.

--circularfilter

If you want to filter out reads that don’t map to a circular chromosome, turn this on. By default this option is turned off.

BWA Mem

--bwamem

Turn this on to utilize BWA Mem instead of bwa aln for alignment. Can be quite useful for modern DNA, but is rarely used in projects for ancient DNA.

Mapped reads Stripping

These parameters are used for removing mapped reads from the original input FASTQ files, usually in the context of uploading the original FASTQ files to a public read archive (NCBI SRA/EBI ENA).

These flags will produce FASTQ files almost identical to your input files, except that reads with the same read ID as one found in the mapped bam file, are either removed or ‘masked’ (every base replaced with Ns).

This functionality allows you to provide other researchers who wish to re-use your data to apply their own adapter removal/read merging procedures, while maintaining anonyminity for sample donors - for example with microbiome research.

--strip_input_fastq

Create pre-Adapter Removal FASTQ files without reads that mapped to reference (e.g. for public upload of privacy sensitive non-host data)

--strip_mode

Read removal mode. Strip mapped reads completely (strip) or just replace mapped reads sequence by N (replace)

Read Filtering and Conversion Parameters

Users can configure to keep/discard/extract certain groups of reads efficiently in the nf-core/eager pipeline.

--bam_discard_unmapped

Defines whether unmapped reads should be discarded and stored in FastQ and/or BAM format separately. The behaviour depends on the choice of the --bam_unmapped_type.

--bam_unmapped_type

Defines how to proceed with unmapped reads: “discard” removes all unmapped reads, “bam” keeps unmapped reads as BAM file, “fastq” keeps unmapped reads as FastQ file, “both” keeps both BAM and FastQ files. Only effective when option --bam_discard_unmapped is turned on.

--bam_mapping_quality_threshold

Specify a mapping quality threshold for mapped reads to be kept for downstream analysis. By default keeps all reads and is therefore set to 0 (basically doesn’t filter anything).

Read DeDuplication Parameters

--dedupper

Sets the duplicate read removal tool. By default uses dedup an ancient DNA specific read deduplication tool. Users can also specify markdup and use Picard MarkDuplicates instead, which is advised when working with paired end data that is not merged beforehand. In all other cases, it is advised to use dedup.

--dedup_all_merged

Sets DeDup to treat all reads as merged reads. This is useful if reads are for example not prefixed with M_ in all cases.

Library Complexity Estimation Parameters

--preseq_step_size

Can be used to configure the step size of Preseqs c_curve method. Can be useful when only few and thus shallow sequencing results are used for extrapolation.

DNA Damage Assessment Parameters

--damageprofiler_length

Specifies the length filter for DamageProfiler. By default set to 100.

--damageprofiler_threshold

Specifies the length of the read start and end to be considered for profile generation in DamageProfiler. By default set to 15 bases.

--run_pmdtools

Specifies to run PMDTools for damage based read filtering and assessment of DNA damage in sequencing libraries. By default turned off.

--udg false

Defines whether Uracil-DNA glycosylase (UDG) treatment was used to repair DNA damage on the sequencing libraries. If set, the parameter is used by downstream tools such as PMDTools to estimate damage only on CpG sites that are left after such a treatment.

--pmd_udg_type `half`

If you have UDGhalf treated data (Rohland et al 2016), specify half as option to this parameter to use a different model for DNA damage assessment in PMDTools. Specify the parameter with full and the DNA damage assesment will use CpG context only. If you don’t specify the parameter at all, the library will be treated as non UDG treated.

--pmdtools_range

Specifies the range in which to consider DNA damage from the ends of reads. By default set to 10.

--pmdtools_threshold

Specifies the PMDScore threshold to use in the pipeline when filtering BAM files for DNA damage. Only reads which surpass this damage score are considered for downstream DNA analysis. By default set to 3 if not set specifically by the user.

--pmdtools_reference_mask

Can be used to set a reference genome mask for PMDTools.

--pmdtools_max_reads

The maximum number of reads used for damage assessment in PMDtools. Can be used to significantly reduce the amount of time required for damage assessment in PMDTools. Note that a too low value can also obtain incorrect results.

BAM Trimming Parameters

For some library preparation protocols, users might want to clip off damaged bases before applying genotyping methods. This can be done in nf-core/eager automatically by turning on the --trim_bam parameter.

--trim_bam

Turns on the BAM trimming method. Trims off [n] bases from reads in the deduplicated BAM file. Damage assessment in PMDTools or DamageProfiler remains untouched, as data is routed through this independently.

--bamutils_clip_left / --bamutils_clip_right

Default set to 1 and clipps off one base of the left or right side of reads. Note that reverse reads will automatically be clipped off at the reverse side with this (automatically reverses left and right for the reverse read).

--bamutils_softclip

By default, nf-core/eager uses hard clipping and sets clipped bases to N with quality ! in the BAM output. Turn this on to use soft-clipping instead, masking reads at the read ends respectively using the CIGAR string.

Library-Type Parameters

These parameters are required in some cases, e.g. when performing in-solution SNP capture protocols (390K,1240K, …) for population genetics for example. Make sure to specify the required parameters in such cases.

--snpcapture false

This is by default set to false, but can be turned on to calculate on target metrics automatically for you. Note, that this requires setting --bedfile with the target SNPs simultaneously.

--bedfile

Can be used to set a path to a BED file (3/6 column format) to calculate capture target efficiency on the fly. Will not be used without --bedfile set as parameter.

Automatic Resubmission

By default, if a pipeline step fails, EAGER2 will resubmit the job with twice the amount of CPU and memory. This will occur two times before failing.

Clean up

Once completed a run has completed, you will have lots of (some very large) intermediate files in your output directory, within the directory named work.

Once you have verified your run completed correctly and everything in the module output directories are present as you expect and need, you can perform a clean up.

Important: Once clean up is completed, you will not be able to re-rerun the pipline from an earlier step and you’ll have to re-run from scratch.

While in your output directory, firstly verify you’re only deleting files stored in work/ with the dry run command:

nextflow clean -n

If you’re ready, you can then remove the files with

nextflow clean -f

This will make your system administrator very happy as you will halve the harddrive footprint of the run, so be sure to do this!

--monochrome_logs

Set to disable colourful command line output and live life in monochrome.

--multiqc_config

Specify a path to a custom MultiQC configuration file.